Calculators
PCR Primer Tm Calculator
Calculate a primer's melting temperature using SantaLucia nearest-neighbour thermodynamics with salt and magnesium correction, plus GC content and basic formulas.
- Runs in your browser
- Nothing uploaded
The tool
Enter your numbers below. Results update as you type, and nothing leaves your browser.
Everything you enter stays on your own machine. Nothing is sent to us or to anyone else, which you can confirm in your browser network tab.
What people use it for
- PCR primer design
- qPCR assay setup
- Choosing annealing temperatures
- Molecular biology coursework
About this tool
What the PCR Primer Tm Calculator does
Primer melting temperature (Tm) is where half the primer is bound to its target. The nearest-neighbour method sums the enthalpy and entropy of each adjacent base pair (SantaLucia 1998 unified parameters), corrects the entropy for salt and computes Tm from primer concentration. Magnesium is converted to an equivalent sodium concentration. Basic GC-content formulas are shown for comparison.
It also works as a primer melting temperature calculator or a oligo Tm calculator.
Formula
- Tm = 1000 ΔH ÷ (ΔS + R ln(Cₜ ÷ 4)) − 273.15
- ΔS(salt) = ΔS + 0.368 × (N − 1) × ln[Na⁺eq]
- [Na⁺eq] = [Na⁺] + 120√([Mg²⁺] − [dNTP]) (mM)
- Basic: Tm = 64.9 + 41 × (GC − 16.4) ÷ N
Worked example
Using the starting values in the calculator above:
| Input | Value |
|---|---|
| Primer sequence (5′→3′) | AGCGGATAACAATTTCACACAGGA |
| Primer concentration | 250 nM |
| Monovalent salt (Na⁺/K⁺) | 50 mM |
| Magnesium (Mg²⁺) | 1.5 mM |
| Total dNTPs | 0.8 mM |
| Result | Value |
|---|---|
| Melting temperature (nearest-neighbour) | 62.3 |
| Suggested starting annealing temperature | 57.3 |
| GC content | 41.7% |
| Length (bases) | 24 |
| Basic Tm formula (°C) | 54.0 |
| Salt-adjusted basic Tm (°C) | 52.0 |
| Sodium-equivalent salt (mM) | 150.40 |
| ΔH (kcal/mol) | -184.4 |
| ΔS salt-corrected (cal/K·mol) | -516.7 |
| Design checks | GC in range, no 3′ GC clamp |
How to read the result
Design primer pairs with Tm values within about 2 to 5 °C of each other.
Aim for 18–25 bases, 40–60% GC and a G or C at the 3′ end, avoiding runs of four or more identical bases.
Related calculators
- Unit Conversion Calculator: Convert between metric and imperial units of length, mass, volume, area, temperature, speed, energy, pressure and data, with every unit in the category shown.
- Currency Converter with Fees: Convert an amount at the mid-market rate and see what you really receive after a bank or card exchange margin and fixed fees.
- Sample Size Calculator: Calculate the survey sample size needed for a confidence level and margin of error, with finite population correction and invitations needed at your response rate.
- Statistical Power Calculator: Find the sample size per group needed to detect a difference between two means or two proportions, and the power achieved with a given sample.
Browse every calculator in Science, Statistics and Everyday Utility Calculators, or talk to us about custom calculators and web tools.
More tools and services
- 1031 Exchange Calculator
- 401(k) Contribution Optimizer
- 529 College Savings Calculator
- A/B Test Significance Calculator
- Accessible Ramp Calculator
- Accounts Payable Aging Calculator
If you would rather someone did this properly for you, we offer Web Design Services and Website Development, SEO Services: Search Engine Optimization, AI Automation Agency.
Questions
Questions about this tool
The things clients actually want to know — costs, timelines, ownership and what happens after launch.
Most accurately with nearest-neighbour thermodynamics, which accounts for sequence order, salt and primer concentration.
Start about 3 to 5 °C below the lower primer Tm and optimise with a gradient PCR.
They use different formulas, parameter sets and salt corrections.
Free strategy session
Let’s build something worth finding.
Tell us where you want the business to be in twelve months. We will come back with a costed plan, a realistic timeline, and the numbers we expect to move — no obligation, no jargon.
- 30-minute call, no pitch deck
- Fixed-price proposal in 48 hours
- You own everything we build
Talk to a developer
Not a sales team
- Response time
- Within 1 business hour
- Where we work
- UK, USA & the Gulf
- Contracts
- No lock-in, monthly rolling
- Working since
- 2023